Comparison of the ELISA and ECL Assay for Vedolizumab Anti-drug Antibodies: Assessing the Impact on Pharmacokinetics and Safety Outcomes of the Phase 3 GEMINI Trials

Vedolizumab immunogenicity was assessed using an enzyme-linked immunosorbent assay (ELISA) with ~ 0.5 ug / mL drug disorders, which may underestimate the on-drug immunogenicity. We aimed to compare the results between ELISA and immunogenicity of a new drug-tolerant electrochemiluminescence (ECL) assay (and two versions of neutralizing tests, drug-sensitive to the drug-tolerant).

ECL assay drug tolerance is ~ 100 times higher than the ELISA (≥ 50 mg / mL vs 0.5 ug / mL to 500 ng / mL positive control), and the sensitivity of the test is <5 ng / mL for both tests. Vedolizumab immunogenicity rated at 2000 GEMINI 1 and 2 patients initially tested by ELISA and retested by the ECL assay. anti-drug antibodies (ADA) results in infusion-related reactions-and pharmacokinetic (PK) was examined using descriptive statistics and population PK analysis.

With the ECL assay, 6% (86/1427) of patients treated with vedolizumab as induction and maintenance therapy ADA-positive tested. Of these, 20 patients with persistent positive and 56 had a neutralizing antibody. By ELISA, 4% (56/1434) of this ADA-positive patients, 9 were constantly positive, and 33 have antibodies. Among 61 patients with infusion-related reactions, 6 (10%) is ADA-positive (2 continuous positive) by ECL assay. By ELISA, 3 (5%) both ADA-positive patients and constantly positive.

Partial results (96%) was similar in both tests. In a population PK models are updated, ADA-positive status is expected to increase linearly vedolizumab clearance by a factor of 1.10 (95% credible interval 1.03 to 1.17), consistent with previous reports. ADA impacts the safety and PK modeling generally remained consistently good using ELISA or ECL assay.

Antitumor effect of humanized anti-tissue factor antibody-drug conjugate in a model of peritoneal disseminated pancreatic cancer

tissue factor (TF) is an attractive target for cancer therapy due to excess in some kinds of malignancies. Additionally, TF has been reported to play a functional role both in the development of cancer and metastasis. Several groups have developed antibody-drug conjugate (ADC) to the TF to be used as a cancer treatment, and has demonstrated efficacy in subcutaneous xenograft models of conventional and patient-derived xenograft model.

However, no previous studies have investigated the effectiveness of anti-TF ADC model with advanced cancer. This study developed the original anti-human TF monoclonal antibody conjugated to monomethyl auristatin E, and evaluated its efficacy in vivo in a xenograft model of pancreatic cancer with peritoneal dissemination. An in vitro study showed that the anti-TF ADC has a strong binding affinity and cytotoxic activity against human pancreatic cancer cells highly expressed TF antigen.

Anti-TF ADC also show greater antitumor effect than the ADC control in the conventional subcutaneous xenograft models, with efficacy depends on TF expression in the tumor tissue. Furthermore, the anti-TF ADC significantly inhibited tumor growth in an orthotopic xenograft model, and extend the lifespan in a murine model of peritoneal dissemination. These results suggest that anti-TF ADC has the potential to be an effective treatment not only for the primary tumor, but also for those who disseminated widely. Therefore, it can be concluded that the ADC targeting TF may be a promising agent for the treatment of advanced pancreatic cancer.

 

Treatment of Antibody-Mediated Rejection After Kidney Transplant: Effects immunology, clinical response, and histologic findings

BACKGROUND antibody-mediated rejection (AMR) prize with clinical manifestations are diverse and may have a potential negative impact on graft function and survival. If not treated successfully, AMR can lead to a 20-30% loss of the graft after one year. Little is known about the efficacy of the treatment of the AMR, and the most appropriate treatment strategy has not been determined.

This study evaluated the effects of AMR treatment with plasmapheresis (PP) and intravenous immunoglobulin (IVIG) on renal function, the intensity of anti-HLA antibodies, and graft biopsy morphology. MATERIALS AND METHODS retrospective cohort study of this center including AMR kidney transplant recipients with biopsy treated with PP and / or IVIG. clinical findings, mean fluorescence intensity of donor-specific antibodies anti-HLA (DSA), and graft histology findings, classified according to the Park scored at the time of AMR and 6 and 12 months later, were evaluated.

Results Of the 42 patients who met the inclusion criteria, 38 (90.5%) received IVIG and 26 (61.9%) underwent PP. At AMR diagnosis, 36 (85.7%) patients had proteinuria, with an estimated glomerular filtration rate they remained stable during follow-up. During the first year, 8 (19.0%) patients experienced graft failure, but did not die with a functioning graft. The decline of class I panel reactive antibodies were observed 6 and 12 months after treatment AMR, with a significant reduction in the DSA-A and -B fluorescence intensity, but there is no change in the DSA-DQ. Graft biopsy showed a reduction in inflammation and score C4D, without any improvement in microvascular inflammation. CONCLUSION AMR reduce treatment related biopsy and serological markers AMR, but does not affect the DSA-DQ.

Tryptophan Oxidation of Monoclonal Antibody under Various Conditions Oxidative Stress: Preparation oxidative Specific Favor Unlike tryptophan residue

oxidation of tryptophan could play an important role in choosing a therapeutic monoclonal antibody for commercialization. Monoclonal antibodies that harbor very sensitive tryptophan residue is usually discarded in favor of antibodies oxidation resistance.

Tryptophan residue individual susceptibility to oxidation is usually evaluated through the forced degradation studies during the development process of molecules. We compared the results of some general forced degradation “stress test” for any tryptophan residues in the monoclonal antibody and found that the oxidation state of high stress consistently give different ratings across the tryptophan residue oxidative sensitivity of individuals compared with long-term thermal stability or low stress conditions. We then determined that this difference in ranking is largely due to an overabundance of double oxidation (ie detected as 32 Da) specific tryptophan residue under high stress conditions as compared to a single oxidation (ie 16 Da).

anti-AXL

YF-PA27171 100 ul
EUR 403
Description: Rabbit polyclonal to AXL

Anti-AXL Antibody

A00226-2 100ug/vial
EUR 294

anti- AXL antibody

FNab00754 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:2000
  • Immunogen: AXL receptor tyrosine kinase
  • Uniprot ID: P30530
  • Gene ID: 558
  • Research Area: Cancer, Immunology, Signal Transduction, Metabolism
Description: Antibody raised against AXL

anti-AXL (1B3A2)

LF-MA30204 100 ul
EUR 425
Description: Mouse Monoclonal to AXL

anti-AXL (7E10)

LF-MA30273 100 ul
EUR 486
Description: Mouse Monoclonal to AXL

Anti-AXL antibody

PAab00754 100 ug
EUR 355

Anti-AXL antibody

STJ119885 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.

Anti-Axl antibody

STJ91791 200 µl
EUR 197
Description: Rabbit polyclonal to Axl.

Anti-Axl Antibody

STJ500198 100 µg
EUR 476

Anti-AXL antibody

STJ22748 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.

Anti-Axl antibody

STJ97643 200 µl
EUR 197
Description: Rabbit polyclonal to Axl.

Anti-Axl antibody

STJ97856 100 µl
EUR 234
Description: Mouse monoclonal to Axl.

Anti-Axl antibody

STJ97857 100 µl
EUR 234
Description: Mouse monoclonal to Axl.

Anti-AXL (6C8)

YF-MA10084 100 ug
EUR 363
Description: Mouse monoclonal to AXL

Anti-AXL (6G1)

YF-MA10085 100 ug
EUR 363
Description: Mouse monoclonal to AXL

Anti-Axl (2C10)

YF-MA12092 100 ug
EUR 363
Description: Mouse monoclonal to Axl

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-Axl Antibody BIOTIN

STJ500199 100 µg
EUR 586

Anti-Axl Antibody FITC

STJ500200 100 µg
EUR 586

Rabbit Anti-Mouse AXL protein IgG-Biotinylated

AXL11-BTN 100 ul
EUR 529

Polyclonal Rabbit Anti-AXL antibody

APR05486G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-AXL . This antibody is tested and proven to work in the following applications:

Anti-Phospho-AXL-Y702 antibody

STJ11100989 100 µl
EUR 393
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.

Anti-Phospho-Axl (Y691) antibody

STJ90939 200 µl
EUR 197
Description: Axl is a protein encoded by the AXL gene which is approximately 98,3 kDa. Axl is localised to the cell membrane. It is involved in the GPCR pathway, ERK signalling, actin nucleation by ARP-WASP complex and activation of cAMP-dependent PKA. This protein falls under the Tyro3-Axl-Mer receptor tyrosine kinase subfamily. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6. Axl is expressed in primary colon tumors but weakly expressed in normal colon tissue. Mutations in the AXL gene may result in lymphocytic choriomeningitis, femoral neuropathy and Borna disease. STJ90939 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This primary antibody specifically binds to endogenous Axl protein which only binds about Y691 when Y691 is phosphorylated.

Mouse AXL shRNA Plasmid

20-abx973661
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AXL ELISA Kit

LF-EK50868 1×96T
EUR 648

Rabbit Anti-Mouse AXL protein IgG, aff pure

AXL11-A 100 ul
EUR 482

Mouse Monoclonal Anti-Human AXL protein IgG-Biotinylated

AXL13-BTN 100 ul
EUR 529

Recombinant AXL Receptor Tyrosine Kinase (AXL)

4-RPL230Hu01
  • EUR 474.53
  • EUR 230.00
  • EUR 1504.48
  • EUR 568.16
  • EUR 1036.32
  • EUR 380.00
  • EUR 3611.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 4.6
Description: Recombinant Human AXL Receptor Tyrosine Kinase expressed in: E.coli

Recombinant AXL Receptor Tyrosine Kinase (AXL)

4-RPL230Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8VIA0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat AXL Receptor Tyrosine Kinase expressed in: E.coli

AXL Antibody

48205-100ul 100ul
EUR 333

AXL Antibody

48205-50ul 50ul
EUR 239

Axl Antibody

39365-100ul 100ul
EUR 390

AXL antibody

10R-1995 100 ul
EUR 327
Description: Mouse monoclonal AXL antibody

AXL antibody

10R-2051 100 ul
EUR 403
Description: Mouse monoclonal AXL antibody

AXL Antibody

1-CSB-PA297707
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

AXL Antibody

1-CSB-PA326981LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

AXL Antibody

1-CSB-PA030245
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

AXL antibody

70R-9655 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal AXL antibody

AXL antibody

70R-51253 100 ul
EUR 287
Description: Purified Polyclonal AXL antibody

AXL Antibody

BF0290 200ul
EUR 376
Description: AXL antibody detects endogenous levels of total AXL.

AXL siRNA

20-abx908739
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AXL siRNA

20-abx908740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AXL Antibody

AF7793 200ul
EUR 376
Description: AXL Antibody detects endogenous levels of AXL.

AXL Antibody

AF8412 200ul
EUR 376
Description: AXL Antibody detects endogenous levels of total AXL.

AXL Antibody

ABF8412 100 ug
EUR 438

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Mouse Monoclonal Anti-Human AXL protein IgG, aff pure

AXL13-M 100 ul
EUR 482

ELISA kit for Mouse AXL

EK5264 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse AXL in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse AXL PicoKine ELISA Kit

EK0660 96 wells
EUR 425
Description: For quantitative detection of mouse AXL in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Axl ORF Vector (Mouse) (pORF)

ORF039463 1.0 ug DNA
EUR 506

Axl ORF Vector (Mouse) (pORF)

ORF039464 1.0 ug DNA
EUR 506

Axl ORF Vector (Mouse) (pORF)

ORF039465 1.0 ug DNA
EUR 506

AXL ELISA Kit (Mouse) (OKBB00412)

OKBB00412 96 Wells
EUR 505
Description: Description of target: Tyrosine-protein kinase receptor UFO is an enzyme that in humans is encoded by the AXL gene. The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, the Axl protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation. This receptor can also mediate cell aggregation by homophilic binding. Axl is a chronic myelogenous leukemia-associated oncogene and also associated with colon cancer and melanoma. It is in close vicinity to the bcl3 oncogene, which is at 19q13.1-q13.2. The Axl gene is evolutionarily conserved between vertebrate species. This gene has two different alternatively spliced transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Rabbit Anti-Human AXL protein IgG-Biotinylated

AXL12-BTN 100 ul
EUR 529

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat)

4-PAL230Ra01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL)

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.

Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

4-SEL230Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO
  • JTK11
  • Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Ra-10x96wellstestplate 10x96-wells test plate
EUR 5621.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Ra-1x48wellstestplate 1x48-wells test plate
EUR 550.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Ra-1x96wellstestplate 1x96-wells test plate
EUR 743.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

SEL230Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.

Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit

4-SEL230Ra
  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO
  • JTK11
  • Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

AXL Rabbit pAb

A0532-100ul 100 ul
EUR 308

AXL Rabbit pAb

A0532-200ul 200 ul
EUR 459

AXL Rabbit pAb

A0532-20ul 20 ul Ask for price

AXL Rabbit pAb

A0532-50ul 50 ul Ask for price

AXL Blocking Peptide

33R-7673 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AXL antibody, catalog no. 70R-9655

AXL antibody (Tyr691)

70R-32634 100 ug
EUR 327
Description: Rabbit polyclonal AXL antibody (Tyr691)

AXL (pT697) Antibody

20-abx009871
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

AXL (pY691) Antibody

abx148474-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

AXL (pY702) Antibody

abx148475-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

AXL Blocking Peptide

20-abx061788
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AXL (pY691) Antibody

20-abx249424
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

AXL Conjugated Antibody

C48205 100ul
EUR 397

Polyclonal AXL Antibody

APR05948G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXL . This antibody is tested and proven to work in the following applications:

AXL Blocking Peptide

BF0290-BP 1mg
EUR 195

AXL cloning plasmid

CSB-CL326981HU-10ug 10ug
EUR 861
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2685
  • Sequence: atggcgtggcggtgccccaggatgggcagggtcccgctggcctggtgcttggcgctgtgcggctgggcgtgcatggcccccaggggcacgcaggctgaagaaagtcccttcgtgggcaacccagggaatatcacaggtgcccggggactcacgggcacccttcggtgtcagctcc
  • Show more
Description: A cloning plasmid for the AXL gene.

AXL Blocking Peptide

AF7793-BP 1mg
EUR 195

AXL Blocking Peptide

AF8412-BP 1mg
EUR 195

AXL Rabbit pAb

A17874-100ul 100 ul
EUR 308

AXL Rabbit pAb

A17874-200ul 200 ul
EUR 459

AXL Rabbit pAb

A17874-20ul 20 ul
EUR 183

AXL Rabbit pAb

A17874-50ul 50 ul
EUR 223

Axl Polyclonal Antibody

ABP57379-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody

ABP57379-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody

ABP57379-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691

Axl Polyclonal Antibody

ABP55772-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

Axl Polyclonal Antibody

ABP55772-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

Axl Polyclonal Antibody

ABP55772-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697

Axl Polyclonal Antibody

ES8372-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Axl Polyclonal Antibody

ES8372-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Axl Polyclonal Antibody

ES6771-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Axl Polyclonal Antibody

ES6771-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

pDONR223-AXL Plasmid

PVTB00185S 2 ug
EUR 356

Axl sgRNA CRISPR Lentivector set (Mouse)

K4394001 3 x 1.0 ug
EUR 339

ELISA kit for Human AXL (AXL Receptor Tyrosine Kinase)

ELK7559 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat AXL (AXL Receptor Tyrosine Kinase)

ELK8078 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC

4-PAL230Ra01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Biotinylated

4-PAL230Ra01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Biotin.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Cy3

4-PAL230Ra01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Cy3.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), FITC

4-PAL230Ra01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with FITC.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), HRP

4-PAL230Ra01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with HRP.

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), PE

4-PAL230Ra01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with PE.

Rabbit Anti-Human AXL protein IgG, aff pure

AXL12-A 100 ul
EUR 482

Rabbit Anti-Human AXL (phosphoY821) IgG (aff pure)

AB-23085-A 100ug
EUR 482

AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC-Cy7

4-PAL230Ra01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC-Cy7.

AXL (Phospho-Tyr703) Antibody

13143-100ul 100ul
EUR 252

AXL (Phospho-Tyr703) Antibody

13143-50ul 50ul
EUR 187

AXL (Phospho-Tyr702) Antibody

12791-100ul 100ul
EUR 252

AXL (Phospho-Tyr702) Antibody

12791-50ul 50ul
EUR 187

AXL Antibody, HRP conjugated

1-CSB-PA326981LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AXL Antibody, FITC conjugated

1-CSB-PA326981LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AXL Antibody, Biotin conjugated

1-CSB-PA326981LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-AXL (Y691) Antibody

1-CSB-PA030244
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-AXL (Y691). Recognizes Phospho-AXL (Y691) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

AXL (pY697) Blocking Peptide

20-abx064128
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AXL ELISA KIT|Human

EF008027 96 Tests
EUR 689

Phospho-AXL (Tyr703) Antibody

AF7293 200ul
EUR 376
Description: Phospho-AXL (Tyr703) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr703.

Phospho-AXL (Tyr691) Antibody

AF8522 200ul
EUR 376
Description: AXL (Phospho-Tyr691) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr691.

Phospho-AXL (Tyr702) Antibody

AF8523 200ul
EUR 376
Description: AXL (Phospho-Tyr702) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr702.

Human AXL shRNA Plasmid

20-abx950384
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AXL (Phospho- Tyr691) Antibody

ABF8522 100 ug
EUR 438

AXL (Phospho- Tyr702) Antibody

ABF8523 100 ug
EUR 438

Human AXL (phosphoY821) peptide

AB-23085-P 100ug
EUR 164

Human AXL ELISA Kit

LF-EK50867 1×96T
EUR 648

pCMV-SPORT6-AXL Plasmid

PVT16334 2 ug
EUR 325

Recombinant Human Axl Protein

RP00087 5 μg
EUR 136

Axl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4394002 1.0 ug DNA
EUR 154

Axl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4394003 1.0 ug DNA
EUR 154

Axl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4394004 1.0 ug DNA
EUR 154

Axl Protein Vector (Mouse) (pPB-C-His)

PV157850 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPB-N-His)

PV157851 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPM-C-HA)

PV157852 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPM-C-His)

PV157853 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPB-C-His)

PV157854 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPB-N-His)

PV157855 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPM-C-HA)

PV157856 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPM-C-His)

PV157857 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPB-C-His)

PV157858 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPB-N-His)

PV157859 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPM-C-HA)

PV157860 500 ng
EUR 1065

Axl Protein Vector (Mouse) (pPM-C-His)

PV157861 500 ng
EUR 1065

Axl (Phospho-Tyr691) Polyclonal Antibody

12335-100ul 100ul
EUR 252

Axl (Phospho-Tyr691) Polyclonal Antibody

12335-50ul 50ul
EUR 187

Phospho-AXL-Y702 Rabbit pAb

AP0848-100ul 100 ul
EUR 384

Phospho-AXL-Y702 Rabbit pAb

AP0848-200ul 200 ul
EUR 554

Phospho-AXL-Y702 Rabbit pAb

AP0848-20ul 20 ul
EUR 183

Phospho-AXL-Y702 Rabbit pAb

AP0848-50ul 50 ul
EUR 265

ELISA kit for Human AXL

EK5263 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human AXL in samples from serum, plasma, tissue homogenates and other biological fluids.

Human AXL PicoKine ELISA Kit

EK0659 96 wells
EUR 425
Description: For quantitative detection of human AXL in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Phospho-AXL (Tyr703) Blocking Peptide

AF7293-BP 1mg
EUR 195

AXL (Phospho-Tyr703) Conjugated Antibody

C13143 100ul
EUR 397

Polyclonal AXL Antibody (C-term)

APR05947G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXL (C-term). This antibody is tested and proven to work in the following applications:

Phospho-AXL (Tyr691) Blocking Peptide

AF8522-BP 1mg
EUR 195

Phospho-AXL (Tyr702) Blocking Peptide

AF8523-BP 1mg
EUR 195

Axl (phospho Tyr691) Polyclonal Antibody

ABP55771-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl phospho Tyr691) from Human, Mouse, Rat. This Axl phospho Tyr691) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the phosphorylation site of Y691

Axl (phospho Tyr691) Polyclonal Antibody

ABP55771-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl phospho Tyr691) from Human, Mouse, Rat. This Axl phospho Tyr691) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the phosphorylation site of Y691

Axl (phospho Tyr691) Polyclonal Antibody

ABP55771-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl phospho Tyr691) from Human, Mouse, Rat. This Axl phospho Tyr691) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the phosphorylation site of Y691

Axl (phospho Tyr691) Polyclonal Antibody

ES6770-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl (phospho Tyr691) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Axl (phospho Tyr691) Polyclonal Antibody

ES6770-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl (phospho Tyr691) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Axl ORF Vector (Rat) (pORF)

ORF063895 1.0 ug DNA
EUR 506

Axl ORF Vector (Rat) (pORF)

ORF063896 1.0 ug DNA
EUR 506

We assume that this is actually a double oxidation mechanically different from the single oxidation is observed and that the high stress conditions support the oxidation mechanism of double (and double oxidation sensitive tryptophan residue) whereas the single oxidation appears to be the main mode of H2O2 oxidation under pressure and length of a term thermal stability and favors a different tryptophan residues are more prone to oxidation mechanism single.

Leave a Reply

Your email address will not be published. Required fields are marked *